Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-200c precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-200c precursor URS0000171525_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-200c: A study confirmed that the 3′UTR of glutathione S-transferase mu 3 is a direct target of hsa-mir-200c by co-transfecting a scrambled control siRNA with different GSTM3 3′UTR plasmids [PMC9688189].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

2D structure Publications