Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-487a-3p URS000016FD1B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-487a: Hsa-mir-487a is a microRNA (miRNA) that has been found to be differentially expressed in various biological contexts. In a study comparing the expression of C14MC miRNA across different histological grades, hsa-mir-487a was one of the miRNAs that showed significant differential expression between grade II and III [PMC6061222]. In another study, hsa-mir-487a was identified as one of the miRNAs whose expression differed between pre- and post-therapeutic patients with osteosarcoma [PMC6959019]. Additionally, hsa-mir-487a has been detected in the microRNA expression profile of sperm from patients with asthenospermia, and it is predicted to target the gene Wfdc3 [PMC5530988]. Furthermore, hsa-mir-487a has been found to have an over-represented binding site among ARGs in NP differentiation [PMC2764345]. The role of hsa-mir-487a in adipogenic differentiation was also investigated, where it was shown to target the gene EHHADH and be involved in amino acid metabolism pathways [PMC6471198]. The regulation of hsa-mir-487a by TGF-β1 was explored, and it was found that NF-kappaB (p65) had binding sites in the upstream region of its promoter [PMC4807160]. Overall, these studies highlight the diverse roles and regulatory mechanisms associated with hsa-mir-487a.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCAUACAGGGACAUCCAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) Bta-Mir-154-P16_3p (mature (guide))
  2. Callithrix jacchus cja-miR-487a
  3. Canis lupus familiaris Cfa-Mir-154-P16_3p (mature (guide))
  4. Capra hircus (goat) chi-miR-487a-3p
  5. Cavia porcellus cpo-miR-487a-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487a-3p
  7. Echinops telfairi Ete-Mir-154-P16_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-487a
  9. Macaca mulatta (Rhesus monkey) mml-miR-487a
  10. Oryctolagus cuniculus ocu-miR-487a-3p
  11. Pan troglodytes ptr-miR-487a
  12. Pongo pygmaeus ppy-miR-487a
  13. Pteropus alecto (black flying fox) pal-miR-487a-3p
Publications