v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-150-5p URS000016FD1A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-150: Hsa-mir-150 is a microRNA that may have a role in immune system regulation and potentially in the regulation of keratinocyte proliferation [PMC3110257]. In a study, monocytes were isolated and then treated with hsa-mir-150 or a control miRNA from Caenorhabditis elegans [PMC6303340]. The study used the Monocyte Isolation Kit II from Miltenyi Biotech to sort the monocytes before treating them with hsa-mir-150 or the control miRNA [PMC6303340]. The hsa-mir-150 was used at a concentration of 2 pM [PMC6303340]. The control miRNA used was miR-39p, which is from Caenorhabditis elegans and was provided as the miRcury LNA microRNA mimic from Exiqon [PMC6303340]. These experimental procedures were conducted to investigate the effects of hsa-mir-150 on monocytes and compare them to the effects of the control miRNA [PMC6303340].

mRNA interactions 8 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
  4. Callithrix jacchus cja-miR-150
  5. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-150
  7. Capra hircus (goat) chi-miR-150
  8. Cavia porcellus cpo-miR-150-5p
  9. Cervus elaphus (red deer) cel-miR-150
  10. Cricetulus griseus (Chinese hamster) cgr-miR-150
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  12. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-150
  14. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  16. Gorilla gorilla ggo-miR-150
  17. Macaca mulatta (Rhesus monkey) mml-miR-150-5p
  18. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-150-5p
  20. Ovis aries oar-miR-150
  21. Pan troglodytes ptr-miR-150
  22. Pongo pygmaeus ppy-miR-150
  23. Python bivittatus pbv-miR-150-5p
  24. Rattus norvegicus rno-miR-150-5p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150
 Publications