Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-79-3p URS0000167E65_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAGCUAGAUUACCAAAGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-79-3p
  2. Anopheles gambiae aga-miR-79
  3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-79
  4. Drosophila ananassae dan-miR-79
  5. Drosophila erecta der-miR-79
  6. Drosophila grimshawi dgr-miR-79
  7. Drosophila mojavensis dmo-miR-79
  8. Drosophila persimilis dpe-miR-79
  9. Drosophila pseudoobscura dps-miR-79
  10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294473_df_nrg
  11. Drosophila sechellia dse-miR-79
  12. Drosophila simulans Dsi-Mir-9-P12-v1_3p (mature (guide))
  13. Drosophila virilis dvi-miR-79-3p
  14. Drosophila willistoni dwi-miR-79
  15. Drosophila yakuba dya-miR-79
  16. Heliconius melpomene (postman butterfly) hme-miR-79
Publications