Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 29 (SNORD29) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 29 (SNORD29) URS0000164B86_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD29: SNORD29 is a C/D box snoRNA that is located within the inside-out gene SNHG1, which also hosts several other snoRNAs [PMC4378963]. SNORD29 is part of a cluster of snoRNAs found on chromosome 11 [PMC4378963]. It is one of the snoRNA families that predate the last eukaryotic common ancestor (LECA) [PMC3511168]. SNORD29 demonstrates high expression and processing selectivity, as it is more abundant than SNORD28 [PMC4465335]. It has also been found to be upregulated in various studies, including in CHIKV-infected cells and in equine aging chondrocytes [PMC9967650] [PMC7461137]. The disruption of the gene encoding SNORD29 has been shown to inhibit the replication of certain viruses, such as HRV16 and HSV2 [PMC9967650]. The host gene SNHG1, which contains SNORD29, has been found to be located on chromosome 11q12.3 and also hosts other snoRNAs such as SNORD31 and SNORD28 [PMC9598326] [PMC7154078]. Additionally, reads derived from other intronic snoRNA families within the same locus have been detected, suggesting that multiple mature snoRNAs may be processed from this region [PMC4159348]. Overall, these findings highlight the importance and diverse roles of SNORD29 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCUAUGAUGAAUCAAACUAGCUCACUAUGACCGACAGUGAAAAUACAUGAACACCUGAGAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications