Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) highly accelerated region 1B (HAR1B) URS000015EEC8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HAR1B: HAR1B is a long non-coding RNA (lncRNA) that may have a connection, at least partially, to the sensitivity of sarcoma cells to the drug pazopanib. It is suggested that a certain level of HAR1B expression may be necessary for pazopanib to be effective in treating sarcoma [PMC8063340]. In comparison to HAR1A, the expression of HAR1B in the human brain is lower [PMC10030831].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGACCCUGCGGUUAAAACCCGCGCGCUGCAGCAUCGCGGAAAACGGGAUUCGCCUCAUUUGAAACUUGAGGAAAAUCUCUAAACACUUUCAUUUUGAUAGAAACCAUUUCCGCCGCUGACGUGCGUCUACGCCCAUCAUUUCAGCUGACACGUUGCUGUAACGUCUCCUCCGUUUCAUGCUCUUUCGAACCCUGUCAGCUGCGGGAAGGAACUUCUAAACUAAAAGCUGGCAAGACUCAGCAGAAAAAAAAUAUCGAAAGCUGCUUCUGCUGCCCCAGCUUCACUCAGGCCCUGGCUGCUCCUUCACUGGUCUACACUGCUGCCUCCUGGAACCACCCACUCUGCAACCAGGUCUGAUGCCCGGUGUGGACAUUCAGGGAUGAGGUCCCCUGGGGCUAAAUGAAUGAACAGAUUCUGAAAAGCAGAAGCUACGUCCGGGGGUCUCUGGGCCACAAAUCACUUUCUGACCUGCAGCCGUGAGGCGUGAGGCUCACUCGGAAGCUCCCGGAACCUGGAGACUGCCCUCACUCAACACUUGAACAAGCAAGGGGCCAGGUUCAAUGAAACACCUGCCCGCCCGGCACACCAGGCUCAAAAGCAAGCAAGCAAGCAAACAAACAAACAAAAUCAAAUCAGGCCUUCACAACUCCCCAAAUCAUGUGUGAGUUUCUACAGAGCAGAAGCCAAAAAUAUAUGUUAUCUAACUAGGUCCUAUUUACAUAUAUUUUUAUGGCUGCUCUAAAAAAUUAUCACAAACAUAGCGGCUUCACCCCGUUUCCCCUGUUGUGAUUAUUACACAUUGGAUGCCUGUAUCAAAAUAUCUCAUGGACCCCAUAAAUAGCAACACCCUGUAUGUACUCAUGACAAUUUUUUAAAAAAGAACACUUACACUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications