Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-222-5p URS0000153377_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-222: Hsa-mir-222 is a microRNA that has been analyzed in the context of EBV+DLBCLe, a type of lymphoma [PMC4322989]. The analysis revealed two subpopulations within the EBV+DLBCLe group, with different behaviors [PMC4322989]. Among those with increased expression of hsa-mir-222, all cases were non-GCB and had the worst prognosis according to Salles algorithm [PMC4322989]. Additionally, a majority of these cases had Ann Arbor stage III or IV and an IPI higher than 2 [PMC4322989]. Although there was a prevalence of clinical features predictive of poor prognosis in cases with increased expression of hsa-mir-222, there was only a statistically significant difference in the Salles classification [PMC4322989].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAGUAGCCAGUGUAGAUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications