v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1352 (LINC01352) URS000014FB6A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01352: LINC01352 is a long non-coding RNA (lncRNA) that is involved in hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC) [PMC8845150]. In HBV-related HCC, the transcription factor ERα can bind to the promoter of LINC01352 by forming a complex with HBx [PMC8845150]. Lasso-Cox regression analysis was performed to identify prognosis-related lncRNAs, and LINC01352 was one of the six lncRNAs found to be associated with prognosis in HCC [PMC9214213]. LINC01352 is a type of long non-coding RNA, which means it does not encode proteins but plays important regulatory roles in various biological processes [PMC8845150]. In HBV-related HCC, it has been found that ERα can bind to the promoter region of LINC01352 by forming a complex with HBx [PMC8845150]. This interaction suggests that LINC01352 may be involved in the development and progression of HBV-related HCC. Furthermore, lasso-Cox regression analysis was performed on a set of lncRNAs, including LINC01352, to identify prognosis-related lncRNAs in HCC [PMC9214213]. This analysis identified six lncRNAs, including LINC01352, as being associated with prognosis in HCC [PMC9214213]. These findings suggest that LINC01352 may have potential as a prognostic biomarker for HCC. In conclusion, LINC01352 is an important long non-coding RNA involved in hepatitis B virus-related hepatocellular carcinoma. It interacts with ERα and HBx and has been identified as one of the prognostic biomarkers for HCC. Further research on the functional roles and mechanisms of action of LINC01352 may provide insights into its potential as a therapeutic target for HCC.

Targeting miRNAs 2 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCAUCAUGAACAAAACCAAGGCAGACAACACUGUCAUUAAUGGAGCUUAUCAUGUAAUACGGAAGCCUGGGAUAAGCAACAAAUUACACAAGUGACAAAUGUGAUGAGUGCUGUGAAGCAGAGUGCGGGGUGCCCAGGGAAUCAGCAGAGCCCUGGAGGAUAACAGCCUGAGCUCCAGGAAGGAAGUUUCUUCAAGUGUAAAAUGAGAGAUUGGAUGGAUCAGAAGAUUCAGGCCUCCUUGAAAAUCCCCAUGGGUGAACCCCAACACACAGGCUAUUCAGCCAGCAGCCCCAAGUCCUUUAUGAAAAGCCAAGGUUGAUUGAAACUCUCCCUUCUCAGGAGAGAAACUAGAGGCAAAGCUUCCUCAUCAGCAGAGAUAAACUUGGCAGGAGCCAAUUCAGGUAGGACCAUGGCCAACUCAGGGCUCGUGCUUGAUCGAAGGGGAUCUGUGUUAGUCAGCAUUCUCCAGAGAAAUGGAACCCAUUGGAUAGAUAUGUAAAGAGAUUUAUUAUGGGAGUUGGCUCAUGCAAUUGUGGAGUCCUAGAAGACCCACCACCUCCUGUCUGCAAGCUGGAGAAACAGCAAAGCCAGUGACGUAAUUAAGUCUGAAUCCAAAGGCAUAAGAUCAAGGAGAACUGAUGGUCACCUGUGUAUACUUCCAUUAUGGCAUGUAACAUGCUGGCAAGAAAUUGAUUCAUUGGGUUGUGUCUUCUCAGCUGCCUGAAGAAUGAAAUCAUAUACUCUAGUUUCAUAUGCCCAGCAUUGUACACAACUUGACACAUCACAGCAGCUCUAGGAAAGCACAUAGGCUGACAACUGAGUGAACAACCCACUGACUGUGUGUCGUUCAGGGUUGGGAAAGCAAGGGCAGGUCUCUGUGCCCCAUCUCUAGCUUUUCCUCAACUUAGGCUUUAUAAACCCUUGCAUCAAAAAAUAAAAGCUAAGGCUAAUUGUUUCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications