Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) JMJD1C antisense RNA 1 (JMJD1C-AS1) URS0000142677_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

JMJD1C-AS1: JMJD1C-AS1 is a long non-coding RNA (lncRNA) that has been implicated in subarachnoid hemorrhage (SAH) [PMC8768506]. It is one of the seven lncRNAs included in a model for predicting SAH [PMC9226973]. Studies have suggested that JMJD1C-AS1, along with other RNAs such as LINC01144, hsa-miR-510, TLR4, ADRB2, and TGFBR3, may serve as potential biomarkers for predicting SAH [PMC9369929]. Additionally, JMJD1C-AS1 has been found to function as a competing endogenous RNA (ceRNA) to suppress the inhibitory effects of hsa-miR-204 on HDAC4 and SIRT1 expression [PMC8768506]. It has also been identified as one of the six independent prognostic lncRNAs in a prognostic risk model for SAH [PMC10027880]. However, in the GSE36791 dataset, JMJD1C-AS1 did not show statistical differences in expression levels between SAH and normal samples [PMC8768506]. Furthermore, JMJD1C-AS1 is among the eight metabolism-related lncRNAs that have been identified as potential candidates for constructing a prognostic signature [PMC7940372]. It is also one of the six valuable independent prognostic lncRNAs identified through LASSO regression analysis among 88 Hippo pathway-related prognostic lncRNAs [PMC10027880]. Finally, JMJD1C-AS1 has been found to be significantly positively correlated with FUBP1 expression in SAH patients [PMC8529087].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCGACCCCUCCGGGAUGGGGGCCAGGGCAGCCUCCGCGGCUAUCCCGGGAGUCCUGCUCCGACACCACCUCCACAGGGGAAGCCGCUCGGAGAGACGCAGGGACCCAGGCAAGGGAUGCGGGCAAACGCGCCAAGGGUUCAGCAGAGGGGCGUGACCGCCAGUUGGCCGGGCUGAGCGAGGCGCCAGAGGGAAGCCUGCAAGGUACGUCUGCGAGAGCCGGGUGCGGGCGCGGCAGGGGAAAAGGGGGGCGCUGACUCUCUUACCGCCAGGUCCGGAUUGCGGCUGUCCCUGUGUGACACGGCUCGGAUGACCCCCGCUCGCCAGCUUCGCCAGCCGCGUCCGCUCUCCCAGCGCUCCGAACGUGCCUCGUCGCCGACCGCCACACACAGGAACCGCUUACCCACCAGCUCUGCCCGCGUCUCUACCGCCAUAGCUGUCGCUGCCGAAGCGGCCGCUGCCUCCUCCAGUGCGAGGGAACCGAUGAAACCUCACUCCUACCGGCCGCUCAUGCUGAGGAGAGCGGACCGGGACACAGCAGCGGACCCGAAAGAGCGCAGACUCGGGACGAACCGGCCGCUCUGCCCCGGACACAGCGACCUCGGGCCCUCCCCGCAAACACUCCUUUGGACUCCCAGAUUCGCAGCCUUGUGCUGCAGCGCCACACAAGAAAACUGAAACAAAACCCAACGCGGCCGUCGAAGACCCCGAGGCAGCCCAGCCGCCGCCACCGCGCCGCGGCCAGUACUGCUCCGUCUCCCUCCCCGGGCAGCGGCGGCGCGCAGCGCGUCUCCUUCCGCCGGCGCGGGCGGGGCAGCAGCCGCGGGAGGGUCGGCGGAACCACCGCAGACGGAAAGUAGUGCCCGGCCCUGCGGAGGCGGCAGCGGCCACUGGGUCCGUCCAGAUCCAGAGGCGGCGGCGGCGGCGGCAGCGGGAGACGAAAAAAUGAAGAGGGCCGCGGGAAAGUAGGCGACAGCUAUUCAAAGCUUUUGGGGGUCUACCUUUGUAUUCGUUGCUCCCUCAGAGGUGGAGGUGAGGGGAAAGUGAAGUGUAGUGGUUCCACUCUGAUCACAAAAUAAACUCCUGGGUUGACGCCUCACCCGCGGUUUGAUGUUCAGAGCACACAGCGCCCGCCGCCUGAGUUAGCCUGAAUUAGCAGUCCCGCAGUAACAGCAGCAGAGCAGGACAACACUUCUACUGAAAACUAAGCCCCAAAGUCACAGCAGAACCAACCGUUCAUGACUUCAAGGGAAAACGAGGGGGAAAAUGUGAUCCUUUCAUUCUUCUCAUUUGUGGUGAUACUAAUUACAUGUUUAAGCUAUUCACAGAUUUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications