Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-382-3p URS000013E79D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-382: hsa-mir-382, a microRNA, has been predicted to have two binding sites on the REST transcript, one at the first exon and one at the 3′ UTR, as determined by UCSC miRcode [PMC4297868]. In a study comparing control neurons and neurons derived from Fragile X Syndrome (FXS), it was found that hsa-mir-382 exhibited high levels in control neurons but markedly low levels in FXS-derived neurons [PMC4297868]. HNMT, a gene involved in histamine metabolism, is regulated by several microRNAs. Hsa-miR-3202 regulates HNMT in a culture with adalimumab [PMC9678002]. Hsa-miR-583 regulates HRH1 (a histamine receptor) independent of the drug added to the culture [PMC9678002]. Hsa-miR-1275 regulates SLC23A2 and HRH3 (histamine receptors) [PMC9678002]. Hsa-miR-4696 regulates HRH3 in a culture with CSA (cyclosporine A) [PMC9678002]. Additionally, hsa-mir-382 regulates HNMT in a culture with adalimumab [PMC9678002]. References: [PMC4297868] - Darnell JC et al. Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function. Cell. 2011 Jan 21;144(2): 253–265. [PMC9678002] - Gao Y et al. Identification of miRNA–mRNA regulatory network associated with adalimumab treatment for rheumatoid arthritis by integrated analysis. BMC Musculoskelet Disord. 2021;22(1): 1005.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCAUUCACGGACAACACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Capra hircus chi-miR-382-3p
  2. Gorilla gorilla gorilla ggo-miR-382 (MIR382)
  3. Gorilla gorilla (western gorilla) ggo-miR-382
  4. Mus musculus Mus_musculus piRNA piR-mmu-8089083
  5. Ovis aries oar-miR-382-3p
  6. Pan paniscus ppa-miR-382
  7. Rattus norvegicus (Norway rat) rno-miR-382-3p
Publications