Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30c precursor (hsa-mir-30c-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30c precursor (hsa-mir-30c-2) URS0000137EDE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR30C2: MIR30C2 is a gene that encodes a microRNA called miR-30c-2 [PMC9708458]. The TonE consensus sequence TGGAAANNYNY, which is regulated by TonEBP, was identified in the regulatory regions of the murine mir324 and MIR30C2 genes [PMC9104010]. The lncRNA LINC00472 includes both the MIR30A and MIR30C2 genes, suggesting that it may be the primary transcript for miR-30a and miR-30c [PMC9512191]. In cases with a miR-30c cluster deletion, MIR30C1 on 1p34.2 was deleted in 2 out of 5 cases, while MIR30C2 on 6q13 was deleted in 4 out of 5 cases [PMC5400605]. The loss rate for MIR30C1 was found to be 88%, while for MIR30C2 it was 32% in samples with a miR-30c cluster deletion [PMC5400605]. In lung adenocarcinoma (LUAD), the expression of COPZ1 was negatively correlated with several microRNAs including MIR221, MIR23A, MIR3677, and MIRLET7D [PMC10137353]. A substitution located in the 10th nucleotide of mature miR-30c-2-5p (n.16C>A) was identified in the sequence of MIR3OC2 [PMC9708458]. NONO interacts with several microRNAs including MIR148B, MIRC93, and MIRO148A as well as protein-coding genes and other non-coding RNAs [PMC9730017]. Frequent amplifications were observed in the genes encoding hsa-mir-30c, MIR30C1, and MIR30C2, and significant changes in the levels of hsa-mir-30c were found in many patients [PMC4129468].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUACUGUAAACAUCCUACACUCUCAGCUGUGGAAAGUAAGAAAGCUGGGAGAAGGCUGUUUACUCUUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications