Homo sapiens (human) hsa-miR-3916

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3916 URS00001310DE_9606

26 nucleotides
7 databases (ENA, GeneCards, LncBase, MalaCards, miRBase, RefSeq, TarBase)
Found in 0 other species
70 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3916: Hsa-mir-3916 is a microRNA that was designed and synthesized by GenePharma (Suzhou, China) [PMC9857260]. In a study, miRNA-mRNA interaction analysis was conducted, and nine miRNAs, including hsa-mir-3916, were identified as potential regulators of target genes [PMC7407898].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAGAGGAAGAAAUGGCUGGUUCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications