Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 31 (SNORD31) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 31 (SNORD31) URS0000130A5F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD31: Different snoRNAs, including SNORD25, SNORD27, SNORD30, and SNORD31, have been found to be dysregulated during the progression and prognosis of multiple myeloma (MM) [PMC9219770]. These snoRNAs have also been shown to be correlated with shorter time to progression (TTP) in patients with smoldering MM (SMM) [PMC8750018]. Additionally, SNORD31 has been identified as a potential prognostic gene for hepatocellular carcinoma (HCC) [PMC9524901]. The snoRNA host gene 1 (SNHG1) contains several snoRNAs including SNORD25, SNORD27, SNORD30, and SNORD31 [PMC4124155]. Furthermore, the association of these snoRNAs with the progression from smoldering to symptomatic MM has been reported [PMC3766210]. The most abundant snoRNAs found in serum exosomes are SNORD100, SNORD27, and SNORD31 [PMC3968297]. It has also been suggested that these snoRNAs may be involved in the regulation of other RNA species such as mRNAs [PMC3401476]. These findings highlight the potential clinical relevance of these specific non-coding RNA families in cancer.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCAGUGAUGAGUUGAAUACCGCCCCAGUCUGAUCAAUGUGUGACUGAAAGGUAUUUUCUGAGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications