Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-200b-5p URS000012A1DD_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-200b: Mmu-mir-200b is a murine microRNA that was selected for qPCR validation of its expression along with 21 other microRNAs [PMC3319598]. Chen et al. discovered that mmu-mir-200b targets the anti-apoptotic protein Bcl2 and Kruppel-like factor 13 [PMC5364990]. In a study, NSCs from normal pregnancy were allowed to adhere for 48 hours, and the expression of mmu-mir-200b was analyzed using a 5' Fluorescein labelled miRCURY LNA ™ probe [PMC3679101]. Knockdown of mmu-mir-200b increased the number of Ng2 positive cells compared to scrambled transfected cells [PMC3679101]. Additionally, knockdown experiments confirmed that mmu-mir-200b is involved in targeting Dcx and Pafah1b1 [PMC3679101].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCUUACUGGGCAGCAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Publications