Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-33b-3p URS00001270D3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-33b: hsa-mir-33b is a microRNA that is involved in various biological processes and has been implicated in multiple types of human cancers [PMC6451803]. It has been shown to bind to the 3' UTR of several genes, including COL1A1, COL3A1, COL4A1, COL6A3, SPARC, THBS2, and VCAN [PMC6009060]. In gastric cancer, hsa-mir-33b is one of the miRNAs that potentially affect development and prognosis by regulating hub genes [PMC6009060]. It has also been found to be dysregulated and prognosis-related in ovarian cancer [PMC6451803]. In hepatocellular carcinoma (HCC), hsa-mir-33b is downregulated and suppresses the proliferation and metastasis of HCC cells through the inhibition of Sal-like protein 4 (SALL4) [PMC6451803]. Furthermore, hsa-mir-33b can inhibit lung adenocarcinoma cell growth, invasion, and epithelial-mesenchymal transition by suppressing Wnt/β-catenin/ZEB1 signaling [PMC6451803]. In cholangiocarcinoma (CCA), low-expression levels of hsa-mir-33b are associated with poor overall survival (OS) in patients [PMC6451803]. However, there are no reports on the involvement of hsa-mir-33b in osteoarthritis pathogenesis or CCA regulatory mechanisms remain largely unclear [PMC5728069] [PMC6451803].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCCUCGGCAGUGCAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Sus scrofa ssc-miR-33b-3p
Publications