Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-376a-3p URS0000126D1F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-376a: Mmu-mir-376a is an up-regulated miRNA that has been identified as significant in several studies [PMC4989891] [PMC5745818]. It is one of the 15 up-regulated miRNAs identified by SAM analysis [PMC4989891]. In a study on mild traumatic brain injury (TBI), mmu-mir-376a was found to be upregulated, indicating its potential as a biomarker for TBI regardless of severity [PMC5745818]. Mmu-mir-376a has been compared to hsa-miR-376b, with mmu-mir-376a showing a higher similarity score (SQ) [PMC2500034]. However, the murine sequence of mmu-mir-376a is one nucleotide shorter and has different alignment characteristics compared to hsa-miR-376b [PMC2500034]. It should be noted that the seed sequence and editing of mmu-mir-376a are not conserved in murine tissue, leading to its exclusion from experiments involving murine tissue [PMC7452086]. Overall, mmu-mir-376a has been identified as an important miRNA in various studies and shows potential for further investigation in different contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCGUAGAGGAAAAUCCACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications