v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 523 (LINC00523) URS0000114413_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00523: LINC00523 is a long non-coding RNA (lncRNA) that has been associated with type 2 diabetes (T2D) [PMC9234217]. In a gene-based analysis, LINC00523 reached genome-wide significance, indicating its potential role in T2D [PMC9234217]. Additionally, LINC00523 has been found to be co-expressed with G protein-coupled receptors (GPCRs) and plasma membrane calcium ATPase (PMCA), suggesting its involvement in intracellular calcium homeostasis and venous congestion [PMC4991739]. High expression of LINC00523 has been associated with poor prognosis in gastric cancer [PMC6614141]. Furthermore, LINC00523 has been identified as a potential diagnostic marker for T2D [PMC7451240]. In another study, LINC00523 was found to have a negative correlation with PD-L1 expression and predicted good prognosis [PMC8974003]. Additionally, dysregulation of LINC00523 has been observed in T2D individuals [PMC7683115]. Overall, these findings suggest that LINC00523 plays a role in the pathogenesis of T2D and may have diagnostic and prognostic value in various diseases. However, further experimental validation is needed to fully understand the mechanisms underlying the involvement of LINC00523 in these conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCCGGAGCACUCCUUCCCUUCCCUGGUUCCUCAAGGCACGGCUCCCCCAGGCAGAUGAAAGCUUAAUAGAGUUUUGCGACAUGAAAGUCAGUCGGAGGAAAGAGCCUUGAACAGUUGUGCGUGAGAGAGAGGCAAGCGCCCGAAAUUAUUUUACGACAAAGGCAGCUCUCUCUGCCACAGAGGCACAGAGGAGAAAGGAGCCCAGGAAACGGGUCAUUUCUUUCGUGGAAAAAUGGAAAUGCUCUGAAGCAUUUUGGGAGACGUGCUGUGAAGCAGGUGACACCAGAAGACAAGGACACUGGGGGCUCCCUGCCGGGAGGCGCAAAAAGCAACUCCCGUUCGAGGGUCAGAGGAGCCUGGAUGCUAAUGUCUCUCCAAAGUGACUUGGAGCCAACUGCCGGAAAGGCCAUGCCCUUAGGAGCACAGGCAGGUCCCAGCUCAGGGAUCAAGAGGUCUGCUGUGUGACCUUCUUCAAGUUCCUGACCCUCUCUGGGCUGCAGUCACCUUAUUCAGAAAAUGGAGAGGCUAGACAAGAAAAUGAUGCUAAUCUCACCCUUUUCUGGGCUGGCAUUUUAUUGAGCACCUACUAGGCGCUGGGCAUUUUGCUAGGCCCUUCGUGCACACUGCCAUGAGAAAUCCACAGCAACCCCAGAGAUGGGUUCAUCAAUAACUCACCAGCAAAUACUUCCUGAGGCCCCACUGUGUGCCGAGCAUGGGCAUAGGUACUGGGCACACCUCGAUGAACAAGGGAGGUAAGGAUGUGACUCUCCUAGAACUUUCUGUCGAGAAGAGGAGAUGGAGAAUAAACAUGGAAACAAGCAAGAUCAUUCUGGAGAAAAUGCAAUCAGAUGAUGUGCUAGAUGGUAACAGAGAGAGGUCGAAUGAGAGAGAGGGCCGUGACAGCCUCUCUGAGAAGCUGAAAUCCAAGCAGAACCUGAAAGACGAGGAGAAACUCAGAUACAUAAAGACUGGGAAAAGCAUUCAAGUAGAGGGAACAGUGCGUGCAAAGGCCCUGAGGUGGGUGCAGUAGAUACCACAGGCCCCCUCACUCGAGACCACUCCAAGCACCUCCUGCCCUCUUGUGCCACAGAGCUCAGAAAGCUAAAGCAAUGUUCCCCAGAGGUCCUGUGGCCAAGGUCCUGCAUGGGCCUGGGUGACCCCUGCAGAAGCUUCUGAGCAAGACUGAGCAGGGAAAGAAAGGCCAUGUCAGAAAACCAUCCUCCAGCGAGCAUGGAGGCAGAGAGUCUCAUCCUGGCAUCCCAGGUGCUGAGCAGAGCAGACAGCAGCAGAGGGGCUCCCUAGAGCAGCUGGGGGCCCUGCCUGUGCCGUCGCUCUUUCCCCUCCCUGCCCUCUGGUCUGACAUCCCAUUGGCAUCACACACGAUGCCUCCCGGAGGUGCUCUUGUGCACACAGCAGGUCAAAGUGCCAGAGAAUUAGAUCCUGUCCUCUUGGGAACAGCCCUCAGCCAGCAGUGAGCCCUUAGGAGGAUGCUCCAAGCUCUAUCCUCCCCGGGUCCAGAGGCCCUGGGAUGGAGCGCCAUUGUGGAAGCAGUGACAACUUGAUGAAGCUCCCUGGGCUGGCCCCUUCCUCUCUGCCUUGUUCCCCGUUCCCUGCAGUCCUGCAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications