Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-975-5p URS00001067E5_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-975: Dme-mir-975 is a microRNA that was found to be less efficiently cleaved by Dicer compared to dme-pre-let-7 and dme-pre-miR-2492 [PMC8761633]. Overexpression of dme-mir-975 resulted in the down-regulation of six out of the nine predicted targets [PMC8581666]. In contrast, overexpression of dsi-miR-975, despite having a higher expression level than dme-mir-975, did not repress any targets [PMC8581666]. The expression of both dme-mir-975 and dsi-miR-975 was found to be high in S2 cells after transfection, with miR-975 not being detected in S2 cells transfected with the ub-Gal4 control [PMC8581666]. Reporter assays conducted in D. melanogaster S2 cells showed that both the dme-mir-975 and the dsi-mir-975 fragments, along with a ub-Gal4 driver, had trans effects on target repression [PMC8581666]. The expression levels of nine predicted targets with an "A" site complementary to the ninth base of mature dme-mir-975 were examined [PMC8581666]. Interestingly, miRNA knockout experiments revealed that knockout of dsi-mir-975 caused modest but significant target derepression, while knockout of dme-mir-975 did not have a similar effect [PMC8042761].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAACACUUCCUACAUCCUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Drosophila erecta der-miR-975-5p
Publications