Homo sapiens (human) TNFRSF10A antisense RNA 1 (TNFRSF10A-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TNFRSF10A antisense RNA 1 (TNFRSF10A-AS1) URS0000101F1E_9606

637 nucleotides
9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE)
Found in 0 other species
22 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TNFRSF10A-AS1: TNFRSF10A-AS1, a long non-coding RNA (lncRNA), has been investigated in relation to colorectal cancer (CRC) [PMC9157619]. To examine the effects of TNFRSF10A-AS1 on CRC biological functions, researchers conducted experiments using miR-3121-3p mimics and inhibitors [PMC9157619]. Univariate Cox regression analysis was performed on a training cohort of CRC patients, identifying 12 lncRNAs, including TNFRSF10A-AS1, with prognostic value in colorectal adenocarcinoma (COAD) [PMC9539748]. Additionally, functional experiments were conducted both in vitro and in vivo to gain further insights into the role of TNFRSF10A-AS1 [PMC9157619].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

(human) hsa-miR-126-5p

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGUAUUCAGUGAUAGCAACAGAAAACAGACUAAUACAAAUAACCAUCAUUUAACUUAGGUUAAUAUAAGAUUUUUAAGUUACCAAAAAUUAAAUAUAAAAAUAUUUAAAAGUAGACAUCUUGGCUAGGUGCAGUGGCUCACGCCCAUAAUCCCAGCACUUUGGGAGGCCGAGCCACCAUGCCCGGCCACACGUAAGUGUUUUGAUUAGUAAAUCCAGGUAGAAGUUGUAUGUGUGAACUGUAAAUAAUGUUGACAACUCUUAAGAAUUGUCUGUUUUAAUUAAACCAAGAAACUUAAACUAGCUUUCUAUUUACUAAAGAUUAUCUCAGAUCACGUGACCUUGAAAAACAUUUAGAUGGGCUCCAGUUUUUCUAAGAAAAUGCUCCAUUUAUGGAAGCAAUUCUUUUCUUUCUUUUAACCAAAUCUUUGCAUAGGUACCAAAUAACACAUUUGUUUAGGAUGAGAGCUGCCCACUGCCCCCGCCAAAAAAAAGUACUUUUAUAUACAAAAGUCCAAAUUUCCAAAGGUAUAUGUACUUUAAUUGUGACUUGAACUCAAGGUAAAUAAAUUAAAUAAUUAAUAAAUUAACCUUAGCUUACUGGACGGCCACCAUCUUAUAUGCUGUUCCCUUGACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications