Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-520a-3p URS0000101689_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-520a: Hsa-mir-520a is a microRNA that has been studied in various contexts [PMC8145322]. One study reported an up-regulation of serum hsa-mir-520a in women who later developed severe preeclampsia [PMC8145322]. Hsa-mir-520a is part of the "miR-302-3p/372-3p/373" and "miR-520" families [PMC9316571]. In colon cancer cells, hsa-mir-520a was found to be downregulated, while in prostate cancer cells, it was found to be differentially expressed [PMC9941246] [PMC6874298]. Hsa-mir-520a was also shown to impair the luciferase activity of PGC (possible target) [PMC8176405]. In gastric cancer cell lines, the expression of hsa-mir-520a was not significantly changed [PMC8176405]. In resistant chronic myeloid leukemia (CML) patients, hsa-mir-520a was downregulated compared to responders [PMC2743636]. Additionally, RAB11A has been identified as a possible target of hsa-mir-520a and has been implicated in resistance to imatinib mesylate (IM) treatment for CML [PMC2743636].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGUGCUUCCCUUUGGACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications