Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-24 precursor (hsa-mir-24-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-24 precursor (hsa-mir-24-2) URS00000FFC8B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR24-2: MIR24-2 is a microRNA that is involved in carcinogenesis, particularly in relation to the lncRNA HULC [PMC7575754]. In the context of bladder cancer (BLCA), the expression of COPZ1 is inversely related to MIR 23A, MIR24-2, MIR27A, and MIR568 [PMC10137353].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGGUUUGUGUACACUGGCUCAGUUCAGCAGGAACAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications