Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Thr (ACN) (MT-TT) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Thr (ACN) (MT-TT) URS00000FCDE9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TT: MT-TT is a mitochondrial transfer RNA (tRNA) gene that is involved in protein synthesis in mitochondria. It has been found that several bird species, including the Anna's hummingbird, red-legged seriema, Swainson's thrush, maguari stork, whiskered treeswift, and European golden plover, have similar patterns of duplicated genes in the mitochondrial control region (CR), including MT-TT [PMC8082918]. Variants at the anticodon stem of MT-TT have been shown to potentially affect tRNA function [PMC7687527]. RNA-seq analyses have revealed differential gene expression in relation to MT-TT. In an anaerobic group compared to an aerobic group, eight genes were expressed significantly higher and nine genes were expressed significantly lower [PMC10076011]. The m.15927G > A and m.15951A > G mutations are known LHON-associated mutations in the MT-TT gene [PMC7687527]. The region containing potentially pathogenic alleles has been identified as including MT-CO3, MT-TA, MT-TC, and MT-TT [PMC6034246]. The m.15951A > G mutation has been found in Chinese families belonging to Eastern Asian mtDNA haplogroup D [PMC7687527]. In a mutational screening study involving patients and controls, no nucleotide changes were detected in the MT-TT gene among controls but at least one variant was identified among affected subjects [PMC7687527]. Fifteen nucleotide changes have been identified within the MT-TT gene with potential structural alterations and functional significance [PMC7687527]. Additionally, higher expression of mitochondrial tRNA genes including MT-TV and MV-TY was associated with Cluster 0 expression patterns [PMC10108821]. D-loop mutations as well as indels events have also been found within the mitochondrial genes encoding 12S rRNA and tRNA threonine (MT-TT) [PMC4083402].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCUUGUAGUAUAAACUAAUACACCAGUCUUGUAAACCGGAGAUGAAAACCUUUUUCCAAGGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cloning vector pRS316-1B9 tRNA-Thr
  2. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Thr
2D structure Publications