Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 28 (SNORA28) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 28 (SNORA28) URS00000F8A5F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA28: SNORA28 is a small nucleolar RNA (snoRNA) that has been studied in various contexts. Unfortunately, there is a lack of association data available for SNORA28 and SNORA13 [PMC7349977]. However, in XTC cells, SNORA28 has been shown to have a functional 18S-828 pseudouridylation pocket, and when expressed in these cells, it leads to pseudouridylation of xl18S rRNA at position 828 [PMC8522698]. SNORA28 has also been studied in relation to osteosarcoma pathogenesis and progression. Overexpression of SNORA28, along with other snoRNAs such as SNORD3A and SNORA13, was observed in U-2OS cells [PMC7349977]. Additionally, increased RNA expression of SNORA28 was observed in the PM10-treated group compared to the control group [PMC7801812]. Constructs have also been made to express SNORA28 as an independent gene [PMC8609340]. These studies highlight the involvement of SNORA28 in various cellular processes and its potential role as a biomarker or therapeutic target. However, further research is needed to fully understand its functions and mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCAACACUCUGUGGCAGAUGAUCAAAACUGUCUGACACAAUUUGAGCUUGCUAUAGCAAGAAAGUCUAACCUAUUCCGGUGUUCUCUCUCCCAUGAGACAAGCCGUUAUAUAGACUUAAACAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications