Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Tyr (UAU/C) (MT-TY) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Tyr (UAU/C) (MT-TY) URS00000F3F5E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TY: MT-TY is a gene that codes for tRNA Tyrosine and is located between MT-TA and MT-TC in the mitochondrial genome [PMC8727539]. Mutations in the MT-TY gene have been reported and are associated with various clinical phenotypes, including chronic external ophthalmoplegia and cardiomyopathy [PMC6311237]. One specific variant, m.5860delTA, has been identified and its effects on mitochondrial function were investigated using patient skeletal muscle tissue [PMC7477489]. The study utilized quantitative fluorescent immunohistochemistry, western blotting, and BN-PAGE analysis to assess the expression of OXPHOS subunits and fully-assembled complexes. The results of this analysis revealed a novel m.5860delTA MT-TY gene variant that presented with childhood-onset mitochondrial myopathy characterized by ophthalmoplegia, ptosis, exercise intolerance, bulbar dysfunction, and nocturnal hypoventilation [PMC7477489]. This study highlights the importance of understanding the genetic basis of mitochondrial diseases such as myopathy to improve diagnosis and treatment strategies for affected individuals.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUAAAAUGGCUGAGUGAAGCAUUGGACUGUAAAUCUAAAGACAGGGGUUAGGCCUCUUUUUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cloning vector pRS316-1B9 tRNA-Tyr
  2. Plasmodium ovale wallikeri tRNA
2D structure Publications