v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2820 URS00000F129B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02820: LINC02820, a long non-coding RNA, may have a significant role in esophageal squamous cell carcinoma (ESCC) [PMC9935391]. In a study, markers for invadopodia were examined, including Cortactin, N-WASP, and phosphorylated N-WASP (p-N-WASP), and it was found that the protein levels of Cortactin and p-N-WASP decreased when LINC02820 was silenced in K180 and K410 cells [PMC9935391]. Additionally, a correlation analysis in esophageal squamous cell carcinoma (ESCA) demonstrated that LINC02820 expression was positively correlated with SF3B3 expression [PMC9935391]. Furthermore, SF3B3 expression was found to be positively correlated with p65(RELA) expression [PMC9935391]. These findings suggest that LINC02820 may be involved in the regulation of invadopodia markers and may have an impact on the expression of SF3B3 and p65(RELA) in ESCA [PMC9935391]. Further research is needed to fully understand the mechanisms by which LINC02820 influences ESCC progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGACUGCUGUGCUAGCAAUCAGCGAGACUCCGUGGGCGUAGGACCCUCCGAGCCAGGCAUCAGCUAUCAAAACUUAUGGGAAAUGGAAUUGAAGACAACUACUUCUAGAAUUGGUGCAUGGAAGCUUCUCAUAGGUGAUUAGCCACACUCUUCUUCUGUCAACCUGGUGCAGAAAAGCUUGAAGACCUUGGAAAUCACAUAUUGAUGAUGGAGGAGAUACAAGAAUGAAGGACCCUGGGUUCCUGAAUCAACACUCUAAGAAGAGACUCCUUGAAAUCAAGAGCACUCAUUUUGACAUUGCAAACGGAAAAAUUCACUUCUAUCAGGUUUGAACCAAUAUAUAGUUUAGGGUUUUUAAAAAAUAACUGUUAGCAUGACUUUAACUAAUACACAUGCCAUACAGGAUCAGACCUCUGUGACUUUGCUUUUACAGUCUGCUCUGUCUGGAGGGGAGUUUCAUCUUUGCCAUCCUUAAUGAUAUAGCAUAGACGCUAUGUCCUCCAGAAACUUCCUUGGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications