Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MYB antisense RNA 1 (MYB-AS1) URS00000EA984_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MYB-AS1: MYB-AS1 is an antisense long non-coding RNA (lncRNA) that is expressed predominantly in pre-B1 and pre-B2 cells and originates from a protein-coding gene involved in B cell development [PMC7072530]. It has been reported to be expressed in various stages of B-cell development [PMC7072530]. MYB-AS1 has been implicated in the pathogenesis of acute myeloid leukemia (AML) [PMC7388210]. A 14-lncRNA risk score system, which includes MYB-AS1, has been proposed for the prediction of AML prognosis [PMC7388210]. MYB-AS1 is one of the antisense lncRNAs associated with early B cell development and is linked to the expression of MYB, a known early B cell transcription factor [PMC8698845] [PMC5890390]. In a prognostic risk model for tumor tissues, MYB-AS1 was found to be downregulated, suggesting its potential protective role in cancer progression [PMC9004096]. MYB-AS1 is a simple transcript with two exons and its expression has been associated with early B-cell development-specific genes such as RAG2, VPREB1, DNTT, LEF1, SMAD1, and MYB [PMC8430640] [PMC8305593] [PMC5601166]. It has also been identified as one of the hub lncRNAs involved in various biological processes including cancer development and progression [PMC6710062]. In combination with PAX8 antisense RNA 1 (PAX8-AS1), MYB-AS1 can serve as an effective predictor for AML prognosis in children [PMC9560823].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAAUUGGAGUGUUUCUGCAAAUUCUAAGAGGUUCUUAACAUUAUCCAGAAUGGUGCCCUGGUGGACGAUCAUGCACCUUGCUGGCGAGGCGCUUUCUUCAGGUCCAUAAAUGCUUGCUGUGAGUGAAGAACUGAAGAACUGUCCUAUUUGCAUUCUAACCACAAAAAAGCUAGAGGACUCAGGAGUUAGAGUUGCUUUGAUCUACACAUAUUCUUGUUGCUUCUAUCCCUUUCUAAUGCUACAGAUUGCACUGAUGCAGUGAAGCACUGCCAAAUCAACGUGGUUAGGAAAGCAGAAGAGCAAAUUAACAGAAGUCUCCUUACAGUAUGACCACACAACAGGAGAAAUUGCAAAACAUUAACUAAAGUUAAAAAGUGGUCGAACUAGCAUGUGCACAUAAACAUCUUAUUAUUUAACAAAAAAUAAAUUUACCCCUAGGAAUACCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications