Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MUC5B antisense RNA 1 (MUC5B-AS1) URS00000E9EFC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MUC5B-AS1: MUC5B-AS1 is a long non-coding RNA (lncRNA) that is upregulated in a concordant fashion with MUC5B in lung adenocarcinoma [PMC5906460]. In this type of cancer, MUC5B-AS1 plays a role in promoting cell migration and invasion by increasing the stability of MUC5B mRNA [PMC8882120]. This mechanism involves the formation of RNA duplexes [PMC8882120]. Additionally, overexpression of MUC5B-AS1 in H1299 cells leads to a significant increase in the number of lung metastatic nodules in mice [PMC5906460]. MUC5B-AS1 is classified as a long non-coding RNA (lncRNA) and has been found to be upregulated alongside MUC5B in lung adenocarcinoma [PMC5906460]. In this type of cancer, MUC5B-AS1 has been shown to promote cell migration and invasion by increasing the stability of MUC5B mRNA through the formation of RNA duplexes [PMC8882120]. This mechanism suggests that MUC5B-AS1 plays a role in regulating gene expression and cellular processes involved in cancer progression. Furthermore, overexpression of MUC5B-AS1 has been found to significantly increase the number of lung metastatic nodules in mice, indicating its potential as a prognostic marker for metastasis [PMC5906460]. References: [PMC5906460] - Zhang Y, Zhang L. Identification and validation long non-coding RNAs for prognosis prediction across 33 cancer types. Oncotarget. 2017;8(45):74545–74556. [PMC8882120] - Zhang Y, Li Z, Li J et al. LncRNA-Mucin 21 promotes cell migration and invasion via repressing KLF4 in lung adenocarcinoma. Thorac Cancer. 2021;12(4):513-523.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUCCAGUGGAUGCAGUCGUAGUGGCUGUUGUGGUCAGCUCUGUGAGGAUCCAGUGGACGCAGUCGUAGUGGCUGUUGUGGUCGGCUUUGUGAGGAUCCAGGUCGUCCCCGGAGUUGAGGAGGGCGUGGCCGUGGAGCUGGUGGCUGGGGUACUGGGGCAGUGGCUGUAGUCGUCACAGCAAAGCACACGCACGUUGUAGUUGAAGCACAUGUUGAACCUGCCUGUCUGGUCUUCGUUCUUGCAGGUCAGCCCCGUCUCCAGGCUGCAGGUCAGCACCUGCCCGACCUGGUCGAUGCUUACCUCGGGGUAGUUCUCCGCCCGGCACUCUAUGCUCUUUGGUGCCCAGCACAUCUUGCCCCCAGCAGCCCUGAUGUUUUCAAAAGUUUCCAUGUCCCCGCCUGCAACCCCUGAGGUUGGGAAGUCCACGUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications