Homo sapiens (human) small nucleolar RNA, H/ACA box 73A (SNORA73A)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, H/ACA box 73A (SNORA73A) URS00000DE3E2_9606

207 nucleotides
6 databases (ENA, GeneCards, HGNC, PSICQUIC, RefSeq, snOPY)
Found in 0 other species
2284 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA73A: SNORA73A is an intron-encoded snoRNA gene that is not associated with SIRT7 in chromatin immunoprecipitation (ChIP) assays [PMC4754350]. It is expressed at high levels, along with RNU1A, RNU5A, and RNU6B [PMC3236229]. No significant differences were found in the Cq values of SNORA73A between different groups [PMC6949321].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UCCAACGUGGAUACACCCGGGAGGUCACUCUCCCCGGGCUCUGUCCAAGUGGCGUAGGGGAGCAUAGGGCUCUGCCCCAUGAUGUACAAGUCCCUUUCCACAACGUUGGAAAUAAAGCUGGGCCUCGUGUCUGCGCCUGCAUAUUCCUACAGCUUCCCAGAGUCCUGUCGACAAUUACUGGGGAGACAAACCAUGCAGGAAACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications