Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-517b-3p URS00000D4AB5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-517a: Hsa-mir-517a is a miRNA that is differentially expressed upon NaB-induced differentiation and is classified as an ES miRNA [PMC2581805]. Mutations in hsa-mir-517a have been associated with lower cancer stages and improved patient survival [PMC7648123]. Hsa-mir-517a is one of the miRNAs analyzed using TaqMan® MicroRNA assays [PMC5496854]. It has been identified as one of the hub genes in a study [PMC9851797]. Hsa-mir-517a is highly decreased in NSC cells compared to iPSC, suggesting its role as a negative regulator of neural differentiation from iPSC [PMC6696086]. It has also been implicated in the transition from ES to NSC and may be characteristic for iPSC to NSC transition [PMC6696086]. Hsa-mir-517a belongs to the Hsa-miR-517 family, which includes hsa-mir-517c and hsa-mir-519a, all transcribed from the C19MC cluster [PMC8666996]. It has been suggested that hsa-miR-519a, along with other differentially expressed miRNAs including hsa-miR-205 and hsa-miR-1, may be involved in the regulation of p53-signaling and apoptosis related genes in recurrent miscarriage pathogenesis [PMC4829624]. High expression of hsa-mir-517a has been associated with worse prognosis for tumor progression/recurrence-free survival and overall survival in glioblastoma patients [PMC6990552]. Additionally, hsa-mir-517a has been identified as one of the crucial miRNAs involved in diminishing pluripotency state and chondrogenic process [PMC6770352].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCGUGCAUCCCUUUAGAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-517c-3p (MIR517C-2)
  2. Gorilla gorilla ggo-miR-517c-3p
  3. Pan troglodytes ptr-miR-517a
  4. Pongo pygmaeus ppy-miR-517a
Publications