Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-25 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-25 precursor URS00000C85B2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-25: Hsa-mir-25 has been found to have more targets in TargetScan compared to most other miRNAs, but fewer targets in miRanda [PMC5581471]. It is also one of the predicted miRNAs for ERS signature genes EDEM1 and BAX [PMC9022475]. In a miRNA expression profiling study, hsa-mir-25 was found to be upregulated in COLO 320 and COLO 205 cells, which are involved in the regulation of cell cycle, cell differentiation, migration, and invasion [PMC9941246]. Additionally, hsa-mir-25 has been implicated in the invasion of prostate cancer and may be involved in signaling mechanisms related to aurora kinase A or integrin [PMC8426106].

MIR25: Using pcDNA3-MCM7-S, heterologous hairpin structures were inserted into the original positions of miR-106b, miR-93, and MIR25 as XhoI/HindIII, EcoRI/BamHI, or XbaI/SacII fragments, respectively [PMC3155610]. Overexpression of MIR25 and miR93 stimulates activation of the AKT signaling pathway, leading to stimulation of cell survival, proliferation, and invasiveness [PMC9864244]. The potential role of MIR25 and miR186 in systemic lupus erythematosus (SLE) has not been explored as extensively as that of miR21 [PMC9013931].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCAGUGUUGAGAGGCGGAGACUUGGGCAAUUGCUGGACGCUGCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCCGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Aotus nancymaae miRNA (ENSANAG00000001216.1)
  2. Artibeus jamaicensis microRNA aja-mir-25 precursor
  3. Callithrix jacchus mir-25 microRNA precursor family
  4. Cavia aperea (Brazilian guinea pig) microRNA 25 (ENSCAPG00000003960.1)
  5. Cavia porcellus microRNA 25 (ENSCPOG00000020044.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 25 (ENSCCAG00000008228.1)
  7. Cercocebus atys miRNA (ENSCATG00000021698.1)
  8. Chinchilla lanigera microRNA 25 (ENSCLAG00000021064.1)
  9. Chlorocebus sabaeus (African green monkey) microRNA 25 (ENSCSAG00000026675.1)
  10. Dipodomys ordii microRNA 25 (ENSDORG00000021715.2)
  11. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021912.1)
  12. Equus caballus microRNA eca-mir-25 precursor
  13. Fukomys damarensis miRNA (ENSFDAG00000005285.1)
  14. Gorilla gorilla gorilla ggo-mir-25 (ENSGGOG00000030506.2)
  15. Gorilla gorilla (western gorilla) microRNA ggo-mir-25 precursor
  16. Heterocephalus glaber (naked mole-rat) mir-25 microRNA precursor family
  17. Jaculus jaculus (Lesser Egyptian jerboa) microRNA 25 (ENSJJAG00000007145.1)
  18. Lagothrix lagotricha microRNA lla-mir-25 precursor
  19. Loxodonta africana microRNA 25 (ENSLAFG00000024311.1)
  20. Macaca mulatta microRNA mml-mir-25 precursor
  21. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-25 precursor
  22. Mandrillus leucophaeus miRNA (ENSMLEG00000016443.1)
  23. Marmota monax non-coding RNA
  24. Microcebus murinus (gray mouse lemur) microRNA 25 (ENSMICG00000035735.2)
  25. Mus caroli (Ryukyu mouse) microRNA 25 (MGP_CAROLIEiJ_G0007991.1)
  26. Mus musculus microRNA mmu-mir-25 precursor
  27. Mus pahari (Shrew mouse) microRNA 25 (MGP_PahariEiJ_G0007290.1)
  28. Mus spretus (algerian mouse) microRNA 25 (MGP_SPRETEiJ_G0008391.1)
  29. Myotis brandtii mir-25 microRNA precursor family
  30. Myotis davidii mir-25 microRNA precursor family
  31. Myotis lucifugus microRNA 25 (ENSMLUG00000017829.1)
  32. Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 25 (ENSNGAG00000007838.1)
  33. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 25 (ENSNLEG00000020339.2)
  34. Octodon degus (Degu) microRNA 25 (ENSODEG00000022414.1)
  35. Oryctolagus cuniculus (rabbit) mir-25 microRNA precursor family
  36. Otolemur garnettii miRNA (ENSOGAG00000017505.1)
  37. Pan paniscus microRNA ppa-mir-25 precursor
  38. Pan troglodytes microRNA ptr-mir-25 precursor
  39. Papio anubis (Olive baboon) mir-25 microRNA precursor family
  40. Pongo abelii mir-25 microRNA precursor family
  41. Pongo pygmaeus microRNA ppy-mir-25 precursor
  42. Propithecus coquereli miRNA (ENSPCOG00000002983.1)
  43. Pteropus alecto (black flying fox) mir-25 microRNA precursor family
  44. Pteropus vampyrus microRNA 25 (ENSPVAG00000024414.1)
  45. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000006748.1)
  46. Rhinopithecus roxellana microRNA 25 (ENSRROG00000003130.1)
  47. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000018881.1)
  48. Sorex araneus (European shrew) microRNA 25 (ENSSARG00000015537.1)
  49. Tupaia belangeri microRNA 25 (ENSTBEG00000017900.1)
  50. Tupaia chinensis (Chinese tree shrew) mir-25 microRNA precursor family
  51. Tursiops truncatus (bottlenosed dolphin) microRNA 25 (ENSTTRG00000022877.1)
2D structure Publications