v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cytoplasmic mesoderm regulator URS00000C1740_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CPMER: CPMER, a functionally conserved long noncoding RNA, was found to interact with eEF1A2 and play a specific role in regulating the translation of Eomes mRNA and cardiac mesoderm (CM) differentiation [PMC9133893]. The expression levels of CPMER increased during CM differentiation and remained high in CMs, while the expression of Eomes was significantly increased during the mesoderm stage but rapidly decreased after mesoderm differentiation [PMC9133893]. Given these findings, the researchers were interested in understanding the roles of CPMER after mesoderm differentiation [PMC9133893].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAUGCUGGGAUUGAUUUGUGAUGUCUGCCACGAAUAUAAGAUUGGCCAUUUGGGGCAUGAAUGCUAUUCAUGGAUUGGAUCUCCUAAGAGCCCGAAUUUCUGAGAAACCACUGAAGACCUGACCCCAGCGCUUAAUUAUUUCUCCUUUCCAAGCAUCUCUCAUGGAAGGCAUCUUGGAUGAAAAGACCUUUGGCAGCGUGGGUUUUGCAGGGACCGUCUGGUACCAGGAACUGGCCAAAUGUGAAGGUGUAAAACACAAAGUUCACACCCUGAAGAACCUUCUAGUCCAGUCGGGGAGAUGGACCCAGAAUGUCAGAUUAAGAUUGGCCUGCAUCAGCCCAAAUGGUUCCAUGUUCUUCUUUUUAAUGGCUGCAUAGUACUCCUUUGCAUGGAUGCACCACAGUUCAUUUAACCAGAGUCCUGUUGGCAGGCAUUUCAGAUGUUUGCAAUUUUUCUGUGAGACCAACACCACUGUGAUCAGCAUCCUGUUGCUGUGUGAAAAGUCCAGGCUAGCCUGCUGGAGGAUGAGUGAUGGGUGAAGCAGAGAUGAAUUUUCAGAGCUGGCUUCAUCUGAGACCAGCCAGCCCUAGCUGUGGAAGGCAGACACUUAGCAAACCCAGCCAAGAUCAGCCAAGCCCAUCCCAGGGCAGAAGAACCACCAAGCUGAUCCCAGUCCACAUCUACUUCUGGAAGCACGUGCUAAAUAAAUGGUUGCUGUUUUAAGCCACUGAGCUAUGGGAGGCUUUGUUUCCCAGCAAUAACUAAUUGAUAAAUCAUCAACAGUAAAAUGGAUAAAUGAAUUGUGGUACAGGCACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications