Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PDE9A antisense RNA 1 URS00000B7DAB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PDE9A-AS1: PDE9A-AS1 is a long non-coding RNA (lncRNA) that showed lower expression levels in tumor tissues compared to matched-peritumoral samples [PMC9960235]. In patients at high risk of colorectal cancer (CRLs), PDE9A-AS1 was found to have low expression levels [PMC9960235]. Additionally, PDE9A-AS1 expression was remarkably lower in colorectal cancer cell lines compared to normal colon cell lines [PMC9960235]. In a study, LASSO regression analysis was performed to identify prognosis-associated CRLs, and PDE9A-AS1 was one of the 10 CRLs identified [PMC9960235]. A prognostic model was constructed using a risk score formula that included PDE9A-AS1 and other CRLs [PMC9960235]. Compared to other cancer types, such as hepatocellular carcinoma and clear cell renal cell carcinoma, the study focused on 10 CRLs, including PDE9A-AS1, as a prognostic signature for colorectal cancer patients [PMC9960235].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUACAGUGGCCCAGGGCAGACUAGCUGGAAUCAGCCUCCCGGGUGGGUUUCGAGGCGUUUCCAGGGUCAGGGGUCAAGUAGGGGCAUGUUCCCGGGACACUGCUUCUUUCUGCCAGAAGGACGAAGAAUCUGGAGAGUGCAAUAUUUGGAUCUGGUCCUGCUGAUGUGUUUCUGUGCUACAGAAACCUUCUCCACCCCUCUUCUACCCAACAGCUAGAGGACAUGGGGUCCGGAAGUGCAUGUGGCUGGAGCCAGUGUGGUCGCUGUCGUGAUGGCCGAGUCCAGAUGAGCUGCCGCUGGGGAAACACAGGGUACCUGAGGUCUGAGGUCGGGACGUCUUUGUCCAACCACUAAGAGUCCACAUUCUCCUUUGGAGCCGGGUCUCCGUUUUCUCCAGCAUCAUGGGCCCCUCAAGGAAGCUGAUGCAUGCCACAGGCUGUCUUCUCAGAAAAGGUACCCAAGAACACAUUUUGGGUUUGCAUGUGGAUUGGGAAGCCCAACGUGGCCUCCAGCGGUGCUCCUUGGCUUUGUCUAGACUGCAGGAUCCCACCCAUGCCCUGUGGAUUUGCCACGUGGACACUGACGUGAGCAAAUGGACAAUUCAACAUCAGUGGCAGAAAGGAGCUCAGUCUGGUUCACACGUGGAAGGCAGCACAUUCUGAAAGAGAAUCACUUGAACCCAGGAGGCGAAGGUUGCAUUGAGCCAAGAUUGUGCUAUUGCACUCCAGCCUGGACAACAGAGCAAGACUCUGUCUCUCAAAAAAAGAAAAAGAAAAGCGACGACAUUCAGUCAAUCAGCCAGAUAUUUUUGGUGAUGCUGCAACUCUUAAUGGUAUCCUGUCUGGAUUCUGUUUAUUUAGUUCCUAAGUUGGUAAAUACAGUGCCUGUUAAUCAUUAACCUUUGCCUUGUCAUUGACAAAGAGUUCACUUGUCAAGCUGUGAGUGGAACACAGAAUUGUGAGGCCUAUGGAAUUCAAGCAUUGAUCUUGAUAUUAUGGAUGAGGACAAAAAGGGUGGGUGACUUGAAGCUGUUUUCUUCCCAGAAUUUGAGCUUUGUGAUCAUUGAAUCAGGACUUGAAUCGACACUCCUUGGCUCCCUAGUCCUUUUUCUGCUUUUCCUUUGGUGGUGAUUGGAGGCUGUAGUAGGCUGUUCUUCUGUUGCUAUAAAGAGAUACCUGAGGCUGGGCAAUUUAUAAGCAAAAGAGGUUUGAUUGGCUCCCAGUUCUGUGGGCUUUACAGGAAGCCUGGUGCCGGCAUCUGCUUGGCUCUUGGGGAGGCCUCGAGAAGCCUCCAAUCAUGGUGGAAGGCAACGGAGAAGCAGGAGGGUAGAGAGAUGCCACGUGCUUUUAAACAACCAGAUCUUGCGAGAACUCACUAUCUCAAGGAGAGCACCAAGCCAUUUAGGAGGCAUCUGCCUGGUGACCCAAACACCUCCCACCAGCCCCACCUCCAACAUUGCGAAUGACAUUUCAACGUGAGAUGUGGAGGGGACAUCCAGACUGUAUCAGAAACCAAGAGAUAACAACUUAGUAGACAUAUUCCAAAAAAUUAUGACCCACAGGGUGCCGAUCAGUGUGCAGAGAAUGUCUUCAUUUACACACAAAAAGACACAGACAAGACACUCAGCAGAGGUUCUCAGAGGGGCUAAGUGCGGAAGGCUUCGUGUGUUCAUUUUUAUUCUUUGGGGCUGAAAGAAUGCUUUAUACCAUGAGCUGUGCUUCUUUUAAAAUAGAAAUAAAAUGCUUAGUUAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications