Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 38 (SNORA38) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 38 (SNORA38) URS00000B589B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA38: SNORA38, a type of small nucleolar RNA, has been found to be associated with E2F targets and the G2M checkpoint, suggesting its potential involvement in cell apoptosis [PMC9500313]. However, the ROC analysis of SNORA38 did not yield statistically significant results, which could be attributed to various factors [PMC9500313].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCCUACAAAGGCGUGUCUGUGGUUCCCUGUCUUUGGACACGUAAGAAUUGGAGGAAAAUAAAUGUGGAUUUGGGAAACUUUGAGGCCAGCUUGCUUCUUGCAGGCUCAUGAUCAACCAAUCUCACAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications