v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-455-5p URS00000AD002_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-455: Hsa-mir-455 is a microRNA that has been found to be significantly correlated with survival time and has diagnostic and preventive potentials [11] [PMC6538694]. It is encoded by the COL27A1 gene located on human chromosome 9 [PMC7560850]. Hsa-mir-455 has been shown to target multiple genes, including COL2A1, HOXC4, COLEC12, KLK12, and STEAP2 [PMC7786978]. It has also been found to be involved in the regulation of autophagy-related gene NKX2–3 [PMC7786978]. In addition, hsa-mir-455 has been associated with various forms of cancer [PMC4022450] [PMC9497140] [PMC8942200].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUGUGCCUUUGGACUACAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus Bta-Mir-455_5p (mature (guide))
  2. Callithrix jacchus cja-miR-455
  3. Canis lupus familiaris cfa-miR-455
  4. Capra hircus (goat) chi-miR-455-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-455-5p
  6. Cervus elaphus cel-miR-455
  7. Cricetulus griseus cgr-miR-455-5p
  8. Dasypus novemcinctus dno-miR-455-5p
  9. Echinops telfairi Ete-Mir-455_5p (mature (guide))
  10. Macaca mulatta mml-miR-455-5p
  11. Mus musculus mmu-miR-455-5p
  12. Nomascus leucogenys nle-miR-455
  13. Oryctolagus cuniculus ocu-miR-455-5p
  14. Pongo pygmaeus ppy-miR-455-5p
  15. Rattus norvegicus (Norway rat) rno-miR-455-5p
  16. Sus scrofa ssc-miR-455-5p
 Publications