Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-193b-3p URS00000AA464_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-193b: Hsa-mir-193b is one of the miRNAs identified in the study as a protective factor for the survival time of acute myeloid leukemia (AML) patients [PMC5634225]. The study also identified other miRNAs, such as hsa-mir-1201, hsa-mir-1978, and hsa-mir-425, as risk factors for AML patient survival [PMC5634225]. The study used in situ hybridization (ISH) probes to detect nucleolar miRNAs, including hsa-miR-191, hsa-miR-193b, hsa-miR-484, and hsa-miR-574-3p [PMC3735495]. These probes were designed with specific sequences to target the respective miRNAs [PMC3735495]. The identification of protective and risk factors for AML patient survival is important for understanding the molecular mechanisms involved in disease progression and prognosis. By studying specific miRNAs like hsa-mir-193b and others mentioned in the study, researchers can gain insights into potential therapeutic targets or prognostic markers for AML patients. These findings contribute to a better understanding of AML biology and may have implications for personalized medicine approaches in the future.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUGGCCCUCAAAGUCCCGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Publications