Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-326 URS00000A939F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-326: Hsa-mir-326 is a microRNA that has been studied in the context of cancer, specifically in resistant chronic myeloid leukemia (CML) patients [PMC2743636]. In a study comparing resistant and responder samples, it was found that 18 miRNAs, including hsa-mir-326, were down-regulated in resistant CML patients [PMC2743636]. Only one miRNA, hsa-miR-191, was found to be up-regulated in the resistant samples [PMC2743636]. The overexpression of hsa-mir-326 has been shown to have beneficial effects in animal models of non-small cell lung cancer (NSCLC), including decreased tumor growth, metastasis, and PD-L1 expression [PMC9659572]. Additionally, it was found to increase the infiltration of CD8+ cells and TNF-α+ IFN-γ+ CD8+ T-cells population in tumor tissues [PMC9659572]. In another analysis comparing responder and nonresponder samples, it was observed that responder samples had significantly elevated expression of hsa-mir-326 compared to nonresponder samples [PMC7794682]. These findings suggest that hsa-mir-326 may play a role in cancer resistance and response to treatment. Further research is needed to fully understand its mechanisms and potential therapeutic applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-326
  2. Canis lupus familiaris cfa-miR-326
  3. Cavia porcellus cpo-miR-326-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-326-3p
  5. Echinops telfairi Ete-Mir-326_3p (mature (guide))
  6. Gorilla gorilla gorilla ggo-miR-326 (MIR326)
  7. Gorilla gorilla ggo-miR-326
  8. Macaca fascicularis microRNA miR-326-3p
  9. Macaca mulatta Mml-Mir-326_3p (mature (guide))
  10. Mus musculus Mmu-Mir-326_3p (mature (guide))
  11. Oryctolagus cuniculus ocu-miR-326-3p
  12. Pan troglodytes (chimpanzee) ptr-miR-326
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-326
  14. Rattus norvegicus Rno-Mir-326_3p (mature (guide))
  15. Sus scrofa ssc-miR-326
Publications