Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 45A (SNORD45A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 45A (SNORD45A) URS00000A3335_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD45A: SNORD45A is a small nucleolar RNA (snoRNA) that has been studied in the context of coronary artery disease. In plaques from patients with coronary atherosclerosis (AS), the levels of SNORD45A were found to be significantly higher compared to the adjacent intima [PMC9046892]. SNORD45A was also among the mRNAs with significant differences in expression levels in these plaques [PMC9046892]. However, when comparing the serum of coronary AS patients and healthy patients, no significant difference was observed in the expression levels of SNORD45A [PMC9046892]. In a study investigating overexpressed genes, SNORD45A was found to be among several snoRNAs that showed high levels of overexpression [PMC7326236]. Additionally, when comparing expression patterns measured by microarray and qPCR, it was found that SNORD45A had lower levels as measured by qPCR [PMC5363543]. The oligonucleotides used for measuring gene expression included a specific primer set for SNORD45A [PMC6124571]. Overall, these findings suggest that SNORD45A may play a role in coronary artery disease and its expression levels may vary depending on the specific context.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCAAUGAUGUGUUGGCAUGUAUUAUCUGAAUCUAUUGCUGAUGUGUAAUAACACUUUAGCUCUAGAAUUACUCUGAGACCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications