Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7d-5p URS00000A07C1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-let-7d: Hsa-let-7d is a microRNA that has been implicated in the development of esophageal squamous cell carcinoma (ESCC) [PMC7899827]. However, further research is needed to fully understand its role before it can be applied in a clinical setting [PMC7899827]. In a study comparing the expression of various microRNAs in acute myocardial infarction (AMI) patients and normal controls, hsa-let-7d was found to be differentially expressed [PMC6388335]. Other microRNAs that showed differential expression included hsa-miR-9-1, hsa-miR-124-3, hsa-miR-5195, hsa-let-7b, hsa-miR-4500, hsa-miR4319, hsa-miR133b, hsa-miR526b [PMC6388335]. These findings suggest that these microRNAs may play a role in the pathogenesis of AMI [PMC6388335]. The study used KROAA005852 and miRNA hsalet7d miRIDIAN Mimic to investigate the expression levels of these microRNAs [PMC3112428]. In conclusion, further research is needed to understand the specific role of hsalet7d in ESCC development and its potential clinical applications. Additionally, the differential expression of various microRNAs may provide insights into the pathogenesis of AMI.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGGUAGUAGGUUGCAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c1_5p (mature (guide))
  2. Anolis carolinensis Aca-Let-7-P2c1_5p (mature (guide))
  3. Bos taurus bta-let-7d
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7d
  5. Callorhinchus milii (elephant shark) Cmi-Let-7-P2c1_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Let-7-P2c1_5p (mature (guide))
  7. Capra hircus chi-let-7d-5p
  8. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
  9. Cervus elaphus cel-let-7d
  10. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
  11. Chrysemys picta bellii Cpi-Let-7-P2c1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-let-7d-5p
  13. Columba livia cli-let-7d-5p
  14. Cricetulus griseus (Chinese hamster) cgr-let-7d-5p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-5p
  16. Echinops telfairi Ete-Let-7-P2c1_5p (mature (guide))
  17. Equus caballus eca-let-7d
  18. Gekko japonicus Gja-Let-7-P2c1_5p (mature (guide))
  19. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c1_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-let-7d
  21. Microcaecilia unicolor Mun-Let-7-P2c1_5p (mature (guide))
  22. Monodelphis domestica Mdo-Let-7-P2c1_5p (mature (guide))
  23. Mus musculus mmu-let-7d-5p
  24. Ophiophagus hannah oha-let-7d-5p
  25. Ornithorhynchus anatinus oan-let-7d-5p
  26. Oryctolagus cuniculus ocu-let-7d-5p
  27. Pan troglodytes ptr-let-7d
  28. Pongo pygmaeus (Bornean orangutan) ppy-let-7d
  29. Python bivittatus (Burmese python) pbv-let-7d-5p
  30. Rattus norvegicus rno-let-7d-5p
  31. Sarcophilus harrisii Sha-Let-7-P2c1_5p (mature (guide))
  32. Scyliorhinus torazame Sto-Let-7-P2c1_5p (mature (guide))
  33. Sphenodon punctatus Spt-Let-7-P2c1_5p (mature (guide))
  34. Sus scrofa (pig) ssc-let-7d-5p
  35. Taeniopygia guttata (zebra finch) tgu-let-7d-5p
Publications