Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-18b-3p URS00000A057E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-18b: Hsa-mir-18b is a microRNA that has been implicated in various biological processes and diseases. It has been suggested that hsa-mir-18b may be involved in the relapsing phase of multiple sclerosis (MS) [PMC4389014]. Additionally, hsa-mir-18b has been predicted to target genes involved in regulating cell cycle, cell projection, cell junction, and cytoskeleton, indicating its potential role in influencing cell proliferation and migration [PMC5379007]. In the context of altered epithelial barriers and cell junctions, hsa-mir-18b was expressed in cultured epithelial cells to identify its involvement in an epithelial-focused functional miR network [PMC6174781]. However, the temperature-responsiveness of hsa-mir-18b observed by microarray was not confirmed by qRT-PCR [PMC4478345]. Furthermore, hsa-mir-18b levels were measured in plasma samples of patients with unprovoked venous thromboembolism (uVTE) to investigate its biological role in VTE. It was found that hsa-mir-18b levels were altered along with other identified differentially expressed genes (DEGs) [PMC8357955]. Hsa-mir-18b is part of a larger group of microRNAs that collectively regulate specific target genes involved in different biological processes. For example, it is part of a group that regulates ESR1-related genes [PMC6176299]. In various cancer types such as serous ovarian carcinoma and Ewing sarcoma, hsa-mir-18b has been shown to be associated with specific gene expression patterns and cellular behaviors [PMC3342161] [PMC7290785]. Finally, it has been suggested that certain miRNAs including hsa-miR-34a and hsa-miR-210, along with hsa-mir-18b, may play critical roles in sudden sensorineural hearing loss (SSNHL) [PMC5708990].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCUAAAUGCCCCUUCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-18b-3p
  2. Oryctolagus cuniculus ocu-miR-18b-3p
Publications