Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-489-3p URS000009C45F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-489: Hsa-mir-489 is a microRNA that has been studied in various contexts, including its role in different diseases and its potential as a therapeutic target. It has been found to be regulated by estrogen (E2) and is involved in the regulation of several other microRNAs [PMC5706292] [PMC9381870]. In the context of prolactin pituitary tumors, hsa-mir-489 has been identified as a potential regulator of hub genes and a key player in tumor aggressiveness [PMC6522832] [PMC9496700] [PMC6609352]. It has also been implicated in the regulation of influenza A virus genes [PMC3851852]. In various types of cancer, including hepatocellular carcinoma, gastric cancer, breast cancer, glioma, hypopharyngeal squamous cell carcinoma, bladder cancer, and colorectal cancer, hsa-mir-489 has been shown to act as a tumor suppressor [PMC6609352]. Additionally, hsa-mir-489 has been associated with histological subtypes of tumors and may have prognostic value [PMC9856807] [PMC7196262]. Furthermore, it has been found to be differentially expressed in primary melanoma and may play a role in invasion and metastasis [PMC2855523]. Hsa-mir-489 is also involved in regulating hub genes associated with pathways such as Alzheimer's disease and colorectal cancer [PMC8241782] [PMC9312389]. It may have functional implications related to depression and autism spectrum disorder (ASD) as well. Finally, high levels of hsa-mir-489 have been linked to poor overall survival rates in certain diseases such as breast cancer.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGACAUCACAUAUACGGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Callithrix jacchus cja-miR-489
  2. Macaca mulatta (Rhesus monkey) mml-miR-489-3p
  3. Pan troglodytes ptr-miR-489
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-489
Publications