Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-506-P1_3p (mature (co-guide)) URS000009A71B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-506: Hsa-mir-506 is a microRNA that has been found to exert a growth-inhibiting function [PMC5226495]. In a study, several differentially expressed microRNAs (DEmiRNAs), including hsa-mir-506, were identified to be closely associated with 12 hub differentially expressed mRNAs (DEmRNAs) [PMC6781644]. Another study demonstrated that over-expression of hsa-mir-506 significantly inhibited the proliferation and metastasis of breast cancer cells [PMC7296691]. Furthermore, an interaction between KCNQ1OT1 and hsa-mir-506 has been identified in the plasma of patients with elevated glucose levels [PMC9451601]. In order to validate the expression of SLC7A8 and hsa-mir-506, a validation cohort consisting of 20 pairs of non-metastasis tissues (NMTs) and lung metastasis OS tissues (LMOTs) was enrolled [PMC9750666]. PCR assays were used to measure the expression levels of several endogenous miRNAs, including hsa-mir-506 [PMC2904378]. Additionally, hsa-mir-506 was found to be one of the top ten upregulated miRNAs in a study that examined differentially expressed miRNAs in breast cancer cells [PMC5072262].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAAGGCACCCUUCUGAGUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications