Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-107 precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-107 precursor URS000008F0CF_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-107: Bta-mir-107 is a member of the brown module and is involved in cellular processes essential for lactation and milk synthesis [PMC6164576]. The human homologue of bta-mir-107, bta-miR-26b, has been shown to play a protective role in breast cancer by promoting apoptosis through targeting SLC7A11 [PMC6164576]. In a study comparing peak and late lactation, several miRNAs were found to be differentially expressed, including bta-miR-15b, bta-mir-107, bta-miR-30b-5p, bta-miR-214, bta-miR-339b, bta-miR-375, and bta-miR-487b [PMC3498112]. The expression levels of these miRNAs were higher in late lactation compared to peak lactation tissue [PMC3498112]. However, the expression pattern of bta-mir-107 did not align with the Solexa sequencing results due to potential deviation in qRT-PCR [PMC3498112]. Despite this discrepancy, the high expression of miR-107 (bta-mir-107) led researchers to focus on its role [PMC9407703]. In terms of cellular fraction analysis for miRNA stability determination, GeNorm recommended using the geometric mean of three stable miRNAs: bta-miR103, bta-mir107, and 28 [PMC9783024]. Additionally, putative functional regulation networks were identified based on correlation patterns between different miRNAs [PMC7106649]. For example, there was a positive correlation between bta-miR24–3p and bta-mir–107 [PMC7106649].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

2D structure Publications