Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 33 (SNORD33) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 33 (SNORD33) URS000008DC88_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD33: SNORD33 is a small nucleolar RNA (snoRNA) that is located in intron 4 of the host gene ribosomal protein L13a (RPL13A) [PMC8764855]. It has been found that knocking down SNORD33 in lung adenocarcinoma and urinary bladder carcinoma cell lines leads to a decrease in cisplatin-induced cell toxicity [PMC8764855]. On the other hand, SNORD33, along with SNORD66 and SNORD76, has been found to be significantly upregulated in non-small cell lung cancer (NSCLC) patients compared to healthy controls [PMC2919450]. This suggests that the elevated expressions of these three genes in plasma may be cancer-associated changes [PMC2919450].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCGGUGAUGAGAACUUCUCCCACUCACAUUCGAGUUUCCCGACCAUGAGAUGACUCCACAUGCACUACCAUCUGAGGCCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications