Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-409-5p URS0000081E1F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-409: Hsa-mir-409 is a microRNA that has been studied in various contexts [PMC4297868]. In one study, iPSCs were transfected with mimic hsa-mir-409, along with other miRNAs, to examine its association with REST. It was found that hsa-mir-409 behaves similarly to other miRNAs but does not have complementary sites on the REST transcript [PMC4297868]. Another study identified hsa-mir-409 as one of the miRNAs involved in the p38 signaling pathway, regulation of p38-alpha and p30-beta pathways, and gluconeogenesis [PMC4464514]. It suggested that upregulated and secreted miRNAs like hsa-mir-409 from neighboring tumor cells could potentially contribute to tumorigenesis [PMC4464514]. Additionally, hsa-mir-409 was identified as a potential diagnostic biomarker for malignant pleural mesothelioma (MPM) due to its association with carcinogenesis mechanisms and upregulation in MPM [PMC4464514]. In osteosarcoma, hsa-mir-409 was found to be downregulated along with several other miRNAs [PMC8746945]. Furthermore, several downregulated non-coding RNAs were clustered on chromosome 14 near hsa-mir-409 [PMC9404356].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUACCCGAGCAACUUUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Publications