Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548o-3p URS0000080D0A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548o: Hsa-mir-548o is a microRNA that has been found to be upregulated in esophageal cancer tissues compared to normal esophageal tissues [PMC8325912]. It has been confirmed to downregulate CAMK1D, indicating its protective role [PMC6448084]. In patients with stomach adenocarcinoma (STAD), high levels of hsa-mir-1255a, hsa-mir-3687, and hsa-mir-9-3 were associated with short survival times, while high levels of hsa-mir-548o and hsa-mir-7-2 were associated with longer survival times [PMC6448084]. Hsa-mir-548o has also been identified as downregulated in glioblastoma and upregulated in cirrhotic hepatocellular carcinoma [PMC6448084]. In a study on STAD patients, a 5-miRNA signature (hsa-mir-1255a, hsa-mir-3687, hsa-mir-9-3, hsa-mir-548o, and hsa-miR7.2) was identified as an independent prognostic predictor of survival time [PMC6448084]. Hsa-mir-548o was found to be positively associated with overall survival time in STAD patients [PMC6448084]. It is worth noting that there are other miRNAs that are also up or down-regulated in various cancers [PMC3794036] and a prognostic panel for gastric cancer patients includes miRNAs such as hsa-mir-548o [PMC7692123]. Additionally, other human miRNA precursors, including hsa-mir-548o, have been found to be duplicated through miRNA sequence homology searches [PMC5959248].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAAAACUGCAGUUACUUUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications