Macaca mulatta (Rhesus monkey) mml-miR-377-3p URS000007F792_9544

• 22 nucleotides
• 4 databases (ENA, miRBase, MirGeneDB, RefSeq)
• Found in 12 other species
• 685 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AUCACACAAAGGCAACUUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Bos taurus (cattle) bta-miR-377
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-377
3. Canis lupus familiaris (dog) Cfa-Mir-154-P6_3p (mature (guide))
4. Cavia porcellus (domestic guinea pig) cpo-miR-377-3p
5. Equus caballus (horse) eca-miR-377
6. Homo sapiens hsa-miR-377-3p
7. Mus musculus (house mouse) mmu-miR-377-3p
8. Oryctolagus cuniculus ocu-miR-377-3p
9. Pan troglodytes (chimpanzee) ptr-miR-377
10. Pongo pygmaeus ppy-miR-377
11. Pteropus alecto (black flying fox) pal-miR-377-3p
12. Sus scrofa (pig) ssc-mir31

Publications Download

• FASTA
• JSON