v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) lncRNA sorafenib resistance in renal cell carcinoma associated (LNCSRLR) URS0000074712_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LNCSRLR: LNCSRLR, a long non-coding RNA (lncRNA), has been found to have the highest coefficient among the lncRNAs studied [PMC9304774]. It has been observed that LNCSRLR is upregulated in renal cell carcinoma patients who exhibit intrinsic resistance to sorafenib, a targeted therapy [PMC7198905]. In vitro experiments using the CCK-8 assay demonstrated that si-LNCSRLR, a small interfering RNA targeting LNCSRLR, suppressed cell proliferation [PMC9304774]. Additionally, high expression of LNCSRLR was associated with an adverse prognosis in renal cell carcinoma patients, as confirmed by Kaplan-Meier survival analysis [PMC9304774]. Furthermore, in hepatocellular carcinoma (HCC) tissues compared to normal tissues, the expression levels of LNCSRLR and other lncRNAs such as LINC01063, PRRT3-AS1, and POLH-AS1 were found to be higher [PMC8919262]. The relative expression of several lncRNAs including LNCSRLR was calculated using the 2–ΔΔCt method with GAPDH as an internal reference gene [PMC7198905]. Moreover, two potential target protein-coding genes (PCGs) were identified for LNCSRLR through screening [PMC7198905]. In conclusion, LNCSRLR is a lncRNA that is upregulated in renal cell carcinoma patients with intrinsic sorafenib resistance and is associated with adverse prognosis. It also exhibits higher expression levels in HCC tissues compared to normal tissues. The findings suggest that targeting LNCSRLR may have therapeutic potential for these cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCUAUUAUGGGUCAGGCACUGUUCCAGGCACCAAGGAUAUGUUGAUGAAGAAGACAUUAUAGUCACUGUGAGAUGGACUUAAAAAGAUAAGGAAGUUGGUUCUACUCCUGUUCUCUUCUUUGGCGACACUUAAUACCCAAAGAAAAUUUCUACUAUCCAUCAACUAGGAUAAGGAGACAUUUUAGUAAUGAUUUGUGAAUUAUGUUACUGUACAUCAGGAAUGGUUUUCAAAAUAUGUAACACCUGGUAUGAUGUAGAUGCCAACUCAUCGGAACAGACUCUGGUUAUAAAAGCAGAUCGGUUCGUUCCUACCAGUGCAAGCCAGCUUAAUAUCUCUUGUGGUACAGUUCAAAGACAUCUCCCAGACAGGCAAUAACAAAUGCUUGAGAGGAUGUGGAGAAAAGGGACCCCUCCACAUUGGGACCACUGCUGUUGAGAAUGUAAUUAAUUACAACCACUAUGGAGUACAGUUUGGAGGUUCCUCAAAAAAACUAAAAAUGGAGCUGCCAUAUGAUACAGCAAUUCCAGUGCUUGAUAUAUACCCAGAAGAAAAAGAAAUCAGUGUGCCGAAGCAAUAUCUGCACUCCUGUGUUUGUUGCAGCACUGUUCACAAUAGGUAAGAUUUGGAGACAGCCUAAAUGUCCAUCCACAGAUGUAUGGAUAUAUUUUUGUUUUAUUCUUAAUAUAUUAAAAUAGAUCAGGAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications