Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-302a-3p URS0000070CD2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-302a: Hsa-mir-302a is one of the miRNAs included in a prognostic model for neuroblastoma, along with hsa-let-7c, hsa-miR-93, hsa-miR-195, hsa-miR-137, hsa-miR-197, hsa-miR-15a, hsa-miR-149, hsa-miR-331, hsa-miR-135a, and hsa-miR-204 [PMC9278893]. The miRNA mimic sequence for hsa-mir-302a is 5′-ACU UAA ACG UGG AUG UAC UUG CU -3′ [PMC9497224]. Applied Biosystem's TaqMan microRNA assays were used to detect and quantify mature microRNAs including hsa-mir 302a [PMC3441572]. Hsa mir 302a was found to be significantly downregulated in certain conditions [PMC4055138]. HSA mir 302a has been shown to regulate vasculogenic targets and act as a tumor suppressor and repressor of cell division. One of its direct targets is VEGFA [PMC6884596]. The luciferase activity in cells transfected with the reporter vector containing the DAZAP2 3'-UTR was significantly decreased by >60% following cotransfection with mimics of HSA mir 302a -d but not with a mimic of HSA miRNA367 [PMC7251312].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGUGCUUCCAUGUUUUGGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Callithrix jacchus cja-miR-302a-3p
  2. Columba livia (rock pigeon) Cli-Mir-430-P3_3p (mature (guide))
  3. Dasypus novemcinctus dno-miR-302a-3p
  4. Macaca mulatta mml-miR-302a-3p
  5. Mus musculus mmu-miR-302a-3p
  6. Oryctolagus cuniculus ocu-miR-302a-3p
  7. Pan troglodytes ptr-miR-302a
Publications