Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000200753.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000200753.1) URS000006D2A0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD56: SNORD56 is a snoRNA that has been studied in various contexts. It has been shown that the expression of wild-type DDX21 rescues the recruitment defects of SNORD56 in cells depleted of endogenous DDX21, while expression of inactive DDX21SAT does not [PMC4288182]. In chronic lymphocytic leukemia (CLL), several snoRNAs, including SNORA31, SNORA6, SNORA62, and SNORA71C, are down-regulated. These snoRNAs are involved in the pseudouridineization of rRNA and their host genes have roles in tumor-related signal transduction [PMC4288182]. Upregulated expression of SNORD116-18, SNORA70F, SNORA74A, SNORD56, and SNORD1A is associated with shorter progression-free survival (PFS) in CLL patients. The functions of these snoRNAs are not well understood but they have been suggested to be involved in the regulation of alternative splicing [PMC8975097]. In CLL cells induced to proliferate, 7 snoRNAs continue to be up-regulated while 2 snoRNAs (SNORA80 and SNORD1A) are down-regulated [PMC8975097]. The regulation of snoRNAs during CLL cell proliferation is complex [PMC8975097]. Additionally, interactions between snoRD16 and SNORD56 may contribute to the regulation of C517 methylation [PMC5612246]. In a study comparing cataract and PEXG groups, lower expression levels were observed for five out of seven snoRNAs including SNORD56 in the PEXG group [PMC9454646]. Overall, these findings highlight the diverse roles and complex regulation mechanisms associated with SnoRD56.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUACAAAGAUAGCAACACUUUUCAUCAACAGCAGUUCACCUAGAGAGAGUCGACACUUUUUGUCUGAGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications