Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30a-3p URS0000065D58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-30a: Hsa-mir-30a is a microRNA that plays a variable role in different types of human cancer [PMC5823624]. In the TF-miRNA-TG_B network, hsa-mir-30a is one of the selected miRNAs, along with hsa-miR-16, hsa-miR-92a, hsa-miR-7, and hsa-miR-26b [PMC8576023]. In a microarray study comparing EP pregnancy-derived tissues to VTOP samples, hsa-mir-30a was found to be downregulated [PMC4094496]. Additionally, three other miRNAs (hsa-miR-196b, hsa-miR-873, and hsa-miR-337-3p) were also downregulated in EP pregnancy-derived tissues compared to VTOP samples [PMC4094496]. On the other hand, three miRNAs (hsa-miR-1288, hsa-miR-451, and hsa-miR223) were found to be upregulated in EP pregnancy-derived tissues compared to VTOP samples [PMC4094496]. These findings suggest that the expression of hsa-mir30a is altered in EP pregnancy-derived tissues compared to VTOP samples. However, it is important to note that the role of this microRNA can vary across different types of human cancer. Further research is needed to fully understand the specific functions and mechanisms of action of this microRNA in different contexts.

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30a-3p
  2. Anolis carolinensis aca-miR-30a-3p
  3. Cavia porcellus cpo-miR-30a-3p
  4. Chrysemys picta cpi-miR-30a-3p
  5. Columba livia (rock pigeon) cli-miR-30a-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  7. Danio rerio dre-miR-30e-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-3p
  9. Gallus gallus (chicken) gga-miR-30a-3p
  10. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  11. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
  13. Ictalurus punctatus ipu-miR-30e
  14. Macaca mulatta (Rhesus monkey) mml-miR-30a-3p
  15. Mus musculus (house mouse) mmu-miR-30a-3p
  16. Ophiophagus hannah oha-miR-30a-3p
  17. Ornithorhynchus anatinus oan-miR-30a-3p
  18. Oryctolagus cuniculus ocu-miR-30a-3p
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-30a-3p
  20. Pan troglodytes ptr-miR-30a-3p
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  22. Python bivittatus pbv-miR-30a-3p
  23. Rattus norvegicus (Norway rat) rno-miR-30a-3p
  24. Salmo salar ssa-miR-30d-3p
  25. Sus scrofa (pig) ssc-miR-30a-3p
  26. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  27. Tor tambroides miR-30e-3p
  28. Tursiops truncatus miR-30a-3p
Publications